snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA28
sequence
AAGCAACACTCTGTGGCAGATGGTCAAAAGTGTCTGACACAATCTGAGCTTGCTATAGC
AGGAAAGTCTAACCTATTCCGATGTTCTCTCTCTGTGGGACAAGCCGTTATATAGACTTT
AACAGA
  Box motif
  Complementary to target RNA
length 125
organism Otolemur_garnettii
snoRNA name SNORA28
alias
chromosome ⁄ contig scaffold_56093
locus ⁄ host gene Mono:270:SNORA28
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved