snOPY snoRNA Orthological Gene Database
Oryzias_latipes SNORD12
sequence
GATGTGGTTAGTGATGCATACGCTTTTTTCCCCGTCTTATCGACCATGGTGAAAAGCTG
CTGATAAGCCAGTTATGTCTGAAACCACATC
  Box motif
  Complementary to target RNA
length 90
organism Oryzias_latipes
snoRNA name SNORD12
alias
chromosome ⁄ contig 20
locus ⁄ host gene Q45RI2_ORYLA
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved