snOPY snoRNA Orthological Gene Database
Oryzias_latipes SNORD111
sequence
TCTGCAGAAATTATGAGTTTTTCATGTCTCTTCTCTGATTCAGCATCTGTGGGGAGAAC
TTTTAGACCTCTGATCTGCAGA
  Box motif
  Complementary to target RNA
length 81
organism Oryzias_latipes
snoRNA name SNORD111
alias
chromosome ⁄ contig 14
locus ⁄ host gene LARP1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved