snOPY snoRNA Orthological Gene Database
Oryzias_latipes SNORA75
sequence
ACCTTCTCATGAGCTCCTCTCAATCGCATCCATGATTCTGTACGGATTCGCACGAGAAG
CAGAGCCAGTGCACAGATCAAAACAGGCTCGCCCTACATGCTTATGGGTGTTGCCCATGT
CTGCTGTGCAACAAAT
  Box motif
  Complementary to target RNA
length 135
organism Oryzias_latipes
snoRNA name SNORA75
alias
chromosome ⁄ contig 4
locus ⁄ host gene NCL
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved