snOPY snoRNA Orthological Gene Database
Oryzias_latipes SNORD59
sequence
TCTTCAGTGATGATTTAATACAGTGACTTTCGTTCTTCTGAGATTACTGAAGCCAACAT
TTCTGTCCTGAGAAGA
  Box motif
  Complementary to target RNA
length 75
organism Oryzias_latipes
snoRNA name SNORD59
alias
chromosome ⁄ contig 7
locus ⁄ host gene NACA2
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved