snOPY snoRNA Orthological Gene Database
Oryzias_latipes SNORD65
sequence
AAACATAAACTGAAATAGCTGGAATTACCGTCAGATTGTTCAGTGGTGATCATAAGGTT
TTCTGAAC
  Box motif
  Complementary to target RNA
length 67
organism Oryzias_latipes
snoRNA name SNORD65
alias
chromosome ⁄ contig 14
locus ⁄ host gene Poly:1:SNORD49
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved