snOPY snoRNA Orthological Gene Database
Oryzias_latipes SNORD88
sequence
CTTCTCCGCTGATGTTTTAGCACTGGGCTCTGAGTCTCCATGAAGAGGCTGTGCATCTT
CGGCCTGACAAGCCGAGGTTTCTGAGGAGAAC
  Box motif
  Complementary to target RNA
length 91
organism Oryzias_latipes
snoRNA name SNORD88
alias
chromosome ⁄ contig 8
locus ⁄ host gene Mono:4:SNORD88
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved