snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD98
sequence
GAGTTATGATGTGTAAATCCTATTCCATTGCTGAAATGCAGTGTGGAACACGATGAACT
GAACTC
  Box motif
  Complementary to target RNA
length 65
organism Oryctolagus_cuniculus
snoRNA name SNORD98
alias
chromosome ⁄ contig GeneScaffold_5431
locus ⁄ host gene CCAR1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved