snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA54
sequence
GAGCACTGTTTGTAAACTGTTAACCTGGCTGTAGTAACAGGTTCCAGTCCAGTGCTACG
GCATTTCCAAAGGCACATAACTGACTGACTAGTGGCTTTCAGTTTCAGGTCTTGGAGACA
AAC
  Box motif
  Complementary to target RNA
length 122
organism Oryctolagus_cuniculus
snoRNA name SNORA54
alias
chromosome ⁄ contig GeneScaffold_808
locus ⁄ host gene NLK
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved