snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD73
sequence
AATGAATGATGACAAAATGTTTCGGTCCCAAATGATATTGATATACACTGATTATACCG
TTACATTATTTCTGACATT
  Box motif
  Complementary to target RNA
length 78
organism Oryctolagus_cuniculus
snoRNA name SNORD73
alias
chromosome ⁄ contig GeneScaffold_3659
locus ⁄ host gene ENSOCUG00000007011
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved