snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA63
sequence
AAGCAGGATTCAGACTACATATAGCTGTTTAGTGCTGTGTTGTCGTTCCCCCTGCTCAA
AGTAAGGTTGTTTCTTACTATNNNNNNNNNNNNNNNNNNNN
  Box motif
  Complementary to target RNA
length 100
organism Oryctolagus_cuniculus
snoRNA name SNORA63
alias
chromosome ⁄ contig GeneScaffold_1838
locus ⁄ host gene IF4A1_RABIT
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved