snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA13
sequence
AGCATTTGTATTGCCTGTTCGCTTTTGGAAATGAGTGAATGTGGTGTCAAGAAAGGCAA
ACAGGGAATACTTTGCAGCCTTTTCTGGCCCTTAGGTTTGGTATCTTCCGTGCAGGAACT
GTACAAGTAACAGTT
  Box motif
  Complementary to target RNA
length 134
organism Oryctolagus_cuniculus
snoRNA name SNORA13
alias
chromosome ⁄ contig GeneScaffold_4092
locus ⁄ host gene ENSOCUG00000006000
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved