snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD95
sequence
GAGCAGTGATGAGCCCAACATGCCATCTGAGTGTGTGCGTGAAAACCCGGAGACTGTTT
CTCAGCTG
  Box motif
  Complementary to target RNA
length 67
organism Oryctolagus_cuniculus
snoRNA name SNORD95
alias
chromosome ⁄ contig GeneScaffold_714
locus ⁄ host gene RBL1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved