snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD85
sequence
GGCAAGGATGATAGATACTTGCCCTCACTTAGACTATAGTTCGTTGATGAGAGCATTGT
TCTGAGCCAG
  Box motif
  Complementary to target RNA
length 69
organism Oryctolagus_cuniculus
snoRNA name SNORD85
alias
chromosome ⁄ contig GeneScaffold_2865
locus ⁄ host gene PUM1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved