snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA20
sequence
ATATTCAAATAAAGACAGTTTGAAAAACACTTGCCAATGCTTTGAGCAGTTATACACAT
GGGATAAAATAATATTGGGCCATTGTAAATGGAGATGAAATGAGTGTCATCTCTCCTACG
CAGTCTAGACATTG
  Box motif
  Complementary to target RNA
length 133
organism Oryctolagus_cuniculus
snoRNA name SNORA20
alias
chromosome ⁄ contig GeneScaffold_1779
locus ⁄ host gene BTN1A1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved