snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA23
sequence
GCTATAATGTGTGCATAGCTTTAATCTGTGTCTGGTAGCAGTGTCTGTCTGTGTTTTGC
ATTCAGATGTTGTTACTCACACATAATGTCATGCAGCCAAAGAATAACATGGGATCATAG
TACTGGTCTAGTGTTGTCTCTTTGGACATAACCACCACTGGCCAGCCTCCAAACTCCCAT
ACACAA
  Box motif
  Complementary to target RNA
length 185
organism Oryctolagus_cuniculus
snoRNA name SNORA23
alias
chromosome ⁄ contig GeneScaffold_6853
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved