snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA36
sequence
TTCCAAAGTGTTGAGTTCAGTTCAGGGCATCTTCCCTGTTCTGTTAATTAAACTTTGGT
ACACTAAAAGGGGTTTGGAGATAGAACTGGATAGAAAGTATCACTATTCGTTTATCTCCC
AGCCTACAGCA
  Box motif
  Complementary to target RNA
length 130
organism Oryctolagus_cuniculus
snoRNA name SNORA36
alias
chromosome ⁄ contig GeneScaffold_2644
locus ⁄ host gene DKC1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved