snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD22
sequence
TCCCAGTGAGGAAACACATATGTTACTTCCTGTCCTATTCCTAGAGCCTGTAAAGGTGG
CCCACTGGGGCTGGCCTGGGAGGAAAGAGGAAAGTGTGTTGCAGAAGGAACTGTCCGAGG
GAT
  Box motif
  Complementary to target RNA
length 122
organism Oryctolagus_cuniculus
snoRNA name SNORD22
alias
chromosome ⁄ contig GeneScaffold_4296
locus ⁄ host gene VPS8
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved