snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snoU6-53
sequence
CCCCTGTGATGAGTTGCCATGCTAATACTGAGACACCAGGACGGGAGTTTTACCCTGCA
CTGGGTGTTATTGAAGTAAACTATACTTCTCGTCAATCTACCTGAGGGGC
  Box motif
  Complementary to target RNA
length 109
organism Oryctolagus_cuniculus
snoRNA name snoU6-53
alias
chromosome ⁄ contig GeneScaffold_918
locus ⁄ host gene CHD8
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved