snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD102
sequence
AGCTTAATGATGATTGTCTTTTTGATTGCTTGAAGCAATATGAAAAACACATTTCACCG
GCTCTGAAAGCT
  Box motif
  Complementary to target RNA
length 71
organism Oryctolagus_cuniculus
snoRNA name SNORD102
alias
chromosome ⁄ contig scaffold_195371
locus ⁄ host gene ENSOCUG00000002506
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved