snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD52
sequence
GGGGATGATGATTTCACAGACTAGAGTCTCTGACCCTGGTCCTGATGTCAAAAATGAGT
TCTGACTC
  Box motif
  Complementary to target RNA
length 67
organism Oryctolagus_cuniculus
snoRNA name SNORD52
alias
chromosome ⁄ contig scaffold_144521
locus ⁄ host gene C6orf48
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved