snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA69
sequence
AAAGCAGGTTGCAATTACAGTGCTTTATTTTGTGAAAGTACTGTCATTATCCTGCTGAA
AGAAAAGCTGTGTTGGTCCTTTTTGATTTTGCCACTGTGCTGGTAAAATCATGACAGACT
GACATCGACAATT
  Box motif
  Complementary to target RNA
length 132
organism Oryctolagus_cuniculus
snoRNA name SNORA69
alias
chromosome ⁄ contig scaffold_211036
locus ⁄ host gene ENSOCUG00000010220
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved