snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snoMBII-202
sequence
TGATGACAGTCTCCGGAATCGCTGCATCGCCTGATGAAAGCGCGTTCGAACCCTTTTAC
CTCTGAGCGCCGAGCCGGGCCC
  Box motif
  Complementary to target RNA
length 81
organism Oryctolagus_cuniculus
snoRNA name snoMBII-202
alias
chromosome ⁄ contig scaffold_54263
locus ⁄ host gene RPL13
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved