snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA15
sequence
GCATGATTGAATACTGTGTTCTTTTGTCAGTAGTTTACACAGCCAGACACCATGCAAAA
GTAGTCTTCCCTTGGAAATCATTTTGGTATGCTGAGTTTTTCTAAGCATATCATTATTGA
AAGTGAATACAAAT
  Box motif
  Complementary to target RNA
length 133
organism Oryctolagus_cuniculus
snoRNA name SNORA15
alias
chromosome ⁄ contig GeneScaffold_5748
locus ⁄ host gene Mono:237:SNORA15
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved