snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus U8
sequence
TTGTCAGATAGGATAATCCTTATCTATTCCTCTTCTTGGAGGGCAGATAGAATATGATG
ATTGGAGTAAAAATAAAGAATATGAGACTGTTTTAATCTGCAGTTAAGTTGCTTGTGGGT
TAGTCTGAT
  Box motif
  Complementary to target RNA
length 128
organism Oryctolagus_cuniculus
snoRNA name U8
alias
chromosome ⁄ contig scaffold_176242
locus ⁄ host gene Mono:11:U8
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved