snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD86
sequence
TGTCATGGTGATGGCTGACCAGGGCTCCCTGGCTTTTACAGGCCTCTGCTGGGGCCGAA
CGGCCAGTGCTGGTGTCTGAGCGATT
  Box motif
  Complementary to target RNA
length 85
organism Oryctolagus_cuniculus
snoRNA name SNORD86
alias
chromosome ⁄ contig scaffold_181365
locus ⁄ host gene Mono:96:SNORD86
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved