snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD22
sequence
TGCCAATGAGGAACAGACATCCTGTCTTACTCCCTGTTTTAATCCCAGAGCCAGTAATG
GTGAACCCACTGGGGTGACTGGGAGATGGGATGAGAACTGGTTCTGTAAGGAACTGTCTG
AGGTGC
  Box motif
  Complementary to target RNA
length 125
organism Oryctolagus_cuniculus
snoRNA name SNORD22
alias
chromosome ⁄ contig scaffold_134645
locus ⁄ host gene Poly:26:SNORD26
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved