snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snoZ39
sequence
GTGCATATGATGAAGCAAATCAGTATGATTACAATCATGATACTGTAAACGCTTTCTGA
TGTA
  Box motif
  Complementary to target RNA
length 63
organism Oryctolagus_cuniculus
snoRNA name snoZ39
alias
chromosome ⁄ contig scaffold_122108
locus ⁄ host gene Mono:103:snoZ39
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved