snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD113
sequence
GGGATCAGTGATGATGACTGGTGGCGGACGTCGCGGTGACGACTGCTGGTCTGGAAGGC
TGAGGTCCAG
  Box motif
  Complementary to target RNA
length 69
organism Oryctolagus_cuniculus
snoRNA name SNORD113
alias
chromosome ⁄ contig scaffold_209684
locus ⁄ host gene Poly:3:SNORD113
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved