snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SCARNA9
sequence
TATCTGAGATCTGCTCATACCAAGGTGGATCAATGATGAAAATAGCCAAATCTAGCATC
AGAAGACCTTCTAGTCTTACCTCATGCATGATCTCCATTGTTCTGAGAAGCAAAACTATC
ATTATTTAAAACAGTATGGGCGTTACATCTGGGGTTTGTGTGTGTGTGTGTGTGTATGTA
TGTATGTATGCATGTGTCTATAAAGATGGCAGTGGATAACTGAAGACTAGATGGATGAAA
TGTGTGTGTGTGTGTAAGTGTGAGAGAGACGGAGAGAGAGGCTAATCTTTTTCTTAGCAA
TGATGAAAAGGTTTTACAAGTGACTTTTATAACTATGAGGTTTTCTACACTTGACCTGAG
CTCA
  Box motif
  Complementary to target RNA
length 363
organism Oryctolagus_cuniculus
snoRNA name SCARNA9
alias
chromosome ⁄ contig scaffold_133812
locus ⁄ host gene mono: SCARNA9
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved