snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snoZ107_R87
sequence
AAGAACTGATGACTTGAGAATATTCAAACTCAATGTTAGAAAAATGGGTAATTTTATTT
TCATAAATGGATTCCTTTTTATGAGGACATATACTGAAGAGTTCTAAT
  Box motif
  Complementary to target RNA
length 107
organism Oryctolagus_cuniculus
snoRNA name snoZ107_R87
alias
chromosome ⁄ contig scaffold_115581
locus ⁄ host gene Mono:84:snoZ107_R87
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved