snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snoPyro_CD
sequence
GGTTATTATGAGTATAGATGATCTGAGCGGTGATGAGGTGGTATATTTCCTTAGCT
  Box motif
  Complementary to target RNA
length 56
organism Oryctolagus_cuniculus
snoRNA name snoPyro_CD
alias
chromosome ⁄ contig scaffold_204620
locus ⁄ host gene Mono:43:snoPyro_CD
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved