snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snoZ30
sequence
ACGCAATGATGAGTGAAGTATAGTCTGACCTGGTATTGCCACTGTTTCAAAGTTGGCTT
TGACCAGGGTATGATCCCTTAATCTTCTCTCTGAGCTG
  Box motif
  Complementary to target RNA
length 97
organism Oryctolagus_cuniculus
snoRNA name snoZ30
alias
chromosome ⁄ contig GeneScaffold_1550
locus ⁄ host gene Mono:234:snoZ30
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved