snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD46
sequence
AACTGGAGTGATGAAAGAGTATCCTTAGGCGTGGTGGTGGCCGTCTTGGTCACTTAGTG
CCACTTGCCAGTGCAAGGACTTGTCATAGTTACACTGACTGGTG
  Box motif
  Complementary to target RNA
length 103
organism Oryctolagus_cuniculus
snoRNA name SNORD46
alias
chromosome ⁄ contig GeneScaffold_3482
locus ⁄ host gene Mono:208:SNORD46
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved