snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA63
sequence
AAGCAGGATTCAGGCTGTAGTATGTGTTTAGTGCTGTGTTATCATCCTCCCTGCTCAAA
ATAAGGTTGTTTCCTAACTATGCTATATCCTTGTAACAGCCAGGGATACTTGGTCTCATA
CAT
  Box motif
  Complementary to target RNA
length 122
organism Oryctolagus_cuniculus
snoRNA name SNORA63
alias
chromosome ⁄ contig GeneScaffold_3812
locus ⁄ host gene Mono:229:SNORA63
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved