snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD113
sequence
TGGGACCGTGATGACAGCTGCCGGCGCATGAGTCTTGGGATGAATAACTCGTGCCCGAA
ACTCTGAGGTCCAG
  Box motif
  Complementary to target RNA
length 73
organism Oryctolagus_cuniculus
snoRNA name SNORD113
alias
chromosome ⁄ contig scaffold_209684
locus ⁄ host gene Mono:31:SNORD113
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved