snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA66
sequence
GTGCAGACCCCATCACTGGCTCTGTGTGATGTGGCAGAAGCGAAGGGAGACAGGTTTGC
TAAAGTAATTGTGGTGATAGAAATGTCTGAGCCTCAGAGGCTGCTGAGGGAGCCCATTCT
ATCCCAGGACGGAG
  Box motif
  Complementary to target RNA
length 133
organism Oryctolagus_cuniculus
snoRNA name SNORA66
alias
chromosome ⁄ contig scaffold_145984
locus ⁄ host gene Mono:131:SNORA66
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved