snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD12
sequence
GCTGGCGTGTATGATGACTGGATTTTTCCCCGGCAGATCGACCGTGTTGATCTACCTTC
TCTAAGCCAGTTTCTGTCTGACCCGCCAGC
  Box motif
  Complementary to target RNA
length 89
organism Oryctolagus_cuniculus
snoRNA name SNORD12
alias
chromosome ⁄ contig GeneScaffold_3669
locus ⁄ host gene Poly:30:SNORD12
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved