snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD91
sequence
CTTAGGAGCCAATGATGTTTTTATGCAAAATGTCTGAACCTGTCTGACGCATCTCAGTG
ATGCATCTCTATGTGGTGCTGAGGCTTCTCTGCCA
  Box motif
  Complementary to target RNA
length 94
organism Oryctolagus_cuniculus
snoRNA name SNORD91
alias
chromosome ⁄ contig GeneScaffold_3398
locus ⁄ host gene Poly:31:SNORD91
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved