snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD75
sequence
AGCCTGTGATGGTTTAAGAGTAGTGGACAGAAGGGATTTCTGAAAATGACGTTCTGAGG
CT
  Box motif
  Complementary to target RNA
length 61
organism Oryctolagus_cuniculus
snoRNA name SNORD75
alias
chromosome ⁄ contig scaffold_210888
locus ⁄ host gene Poly:1:SNORD24
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved