snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snoU2_19
sequence
GATCAATGATGAAAATAGCCAAATCTAGCATCAGAAGACCTTCTAGTCTTACCTCATGC
ATGATCTCCATTGTTCTGAGA
  Box motif
  Complementary to target RNA
length 80
organism Oryctolagus_cuniculus
snoRNA name snoU2_19
alias
chromosome ⁄ contig scaffold_140879
locus ⁄ host gene Poly:9:snoU2_19
organization Poly
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved