snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA28
sequence
AAGCAACACTCTGTGGCAGACTGTCAAAACCATCTGACACAATTTGAGCTTCCTATAGC
AAGGAAGTCTAAACTGCTCCAGAAATCTCTCTTCTGTTACACAAGCCATTATATTATACT
TAAGCAGT
  Box motif
  Complementary to target RNA
length 127
organism Oryctolagus_cuniculus
snoRNA name SNORA28
alias
chromosome ⁄ contig scaffold_69555
locus ⁄ host gene Mono:83:SNORA28
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved