snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snoJ33
sequence
AAGTGTTAAGAATGATGTACTACTATAGGTTTAATGAGTTGTTACTTTTAAAATTTACT
ACATGTGAGTAAAATAGACATCCTT
  Box motif
  Complementary to target RNA
length 84
organism Oryctolagus_cuniculus
snoRNA name snoJ33
alias
chromosome ⁄ contig scaffold_9722
locus ⁄ host gene Mono:71:snoJ33
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved