snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD58
sequence
CTGCAGTGATGCTTTTCTTAGGACACCTTTGGAGTTAGCCGTGAAATAACCAATCAGTT
CTGAGCGGC
  Box motif
  Complementary to target RNA
length 68
organism Oryctolagus_cuniculus
snoRNA name SNORD58
alias
chromosome ⁄ contig GeneScaffold_5759
locus ⁄ host gene Poly:28:SNORD58
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved