snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA62
sequence
TTCTCTCACTATGTAACTCTGCCTTTCAAATAAATAAACTTTTTTTTTTTTAAAAAAAG
AGTGTAGATAGTGTGCTACATGAGAAGAAAGTTTTTCTGCTAACACCACAAGGGTCCATG
GCCTGATGAAGGGAGTTGGCTAGTGATTCTTGCTACAAGT
  Box motif
  Complementary to target RNA
length 159
organism Oryctolagus_cuniculus
snoRNA name SNORA62
alias
chromosome ⁄ contig scaffold_11973
locus ⁄ host gene Mono:89:SNORA62
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved