snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD49
sequence
TGACCTGATTATATTAGTAATAGGAAGTGCAATAAGAAGCAATAACTGATGATGTTTAT
GCCCATCTGACT
  Box motif
  Complementary to target RNA
length 71
organism Oryctolagus_cuniculus
snoRNA name SNORD49
alias
chromosome ⁄ contig scaffold_167644
locus ⁄ host gene Mono:155:SNORD49
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved