snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snoU2-30
sequence
AAGCAATGACAAAGGGTTTCCAACTGACCTTTGTAACTACGAAGTTTTCTACACTTGAC
CTGAGCTCA
  Box motif
  Complementary to target RNA
length 68
organism Oryctolagus_cuniculus
snoRNA name snoU2-30
alias
chromosome ⁄ contig scaffold_165448
locus ⁄ host gene Mono:152:snoU2-30
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved