snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORND104
sequence
GCGGTGATGACATCCAAATTAAAGCACGTGTTAGACTGCTGATGCGGGTGATGCGAACT
GGAGTCTGAGC
  Box motif
  Complementary to target RNA
length 70
organism Oryctolagus_cuniculus
snoRNA name SNORND104
alias
chromosome ⁄ contig GeneScaffold_5803
locus ⁄ host gene Poly:32:SNORND104
organization Poly
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved