snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snosnR60_Z15
sequence
TTAGATACAATGATGATAATATAGTTTAGCAGACCGACACTGATGAACAATATTAAAAA
TTATATTATCTTTCCATTTTGAATATTGTA
  Box motif
  Complementary to target RNA
length 89
organism Oryctolagus_cuniculus
snoRNA name snosnR60_Z15
alias
chromosome ⁄ contig GeneScaffold_3504
locus ⁄ host gene Mono:200:snosnR60_Z15
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved