snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus U3
sequence
CAGACGATGACTTCAGGGATCATGTCTGTAGCTCATTACTAGAGAAATTTGAGTGTGTA
GAGCACAGGAAACCATGAGGAGGTGGCTCGGCATTCTCCCTGAGTGTGAAGCTGGCTCTT
GGTGTTACTTCTTCAGGAATGTCATTGGCCATTATGGTTGCCCTTTGTAGGGGTAAGAGG
AGGGGACACAGTTTGG
  Box motif
  Complementary to target RNA
length 195
organism Oryctolagus_cuniculus
snoRNA name U3
alias
chromosome ⁄ contig scaffold_153508
locus ⁄ host gene Mono:139:U3
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved